90
|
SourceForge net
bowtie2 (version 2.2.5 Bowtie2 (Version 2.2.5, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/bowtie2/pmc06652224-200-5-8 Average 90 stars, based on 1 article reviews
bowtie2 (version 2.2.5 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Johns Hopkins HealthCare
bowtie2 Bowtie2, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/bowtie2/pmc09064024-104-29-35 Average 90 stars, based on 1 article reviews
bowtie2 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
SourceForge net
bwa version 0.7.12 Bwa Version 0.7.12, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/bwa+mem/pmc05551020-269-10-14 Average 90 stars, based on 1 article reviews
bwa version 0.7.12 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Refgen Technologies INC
maize b73 reference genome refgen_v3 Maize B73 Reference Genome Refgen V3, supplied by Refgen Technologies INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/b73+reference+genome/pmc05452966-86-7-11 Average 90 stars, based on 1 article reviews
maize b73 reference genome refgen_v3 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
99
|
Illumina Inc
prep kit Prep Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/TruSeq+DNA+Library+Prep/pmc09525273-351-10-12 Average 99 stars, based on 1 article reviews
prep kit - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
98
|
Illumina Inc
hiseq 2500 Hiseq 2500, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/HiSeq+2500+Installation+and+Operational+Qualification/pmc09175372-97-6-8 Average 98 stars, based on 1 article reviews
hiseq 2500 - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
90
|
Johns Hopkins HealthCare
tophat2 release 2.0.13 Tophat2 Release 2.0.13, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/tophat2/pmc06147129-316-26-38 Average 90 stars, based on 1 article reviews
tophat2 release 2.0.13 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Partek
partek flow software Partek Flow Software, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/flow+partek+software/bio_rxiv__2025__10__16__681134-170-8-14 Average 86 stars, based on 1 article reviews
partek flow software - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
90
|
Johns Hopkins HealthCare
blastn tool Blastn Tool, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/blastn+tool/pmc11942432-116-36-66 Average 90 stars, based on 1 article reviews
blastn tool - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Tree Star Inc
carlifornia flowjo 8 7 treestar Carlifornia Flowjo 8 7 Treestar, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/7+8+carlifornia+flowjo+treestar/pm28514690-258-62-65 Average 86 stars, based on 1 article reviews
carlifornia flowjo 8 7 treestar - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
94
|
Addgene inc
gatccagttcacatcgctata Gatccagttcacatcgctata, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/AAV-shRNA-ctrl+(Plasmid+%2385741)/pm37209098-167-62-69 Average 94 stars, based on 1 article reviews
gatccagttcacatcgctata - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
93
|
Illumina Inc
wg 355 1001 truseq rna sample preparation v2 illumina cat Wg 355 1001 Truseq Rna Sample Preparation V2 Illumina Cat, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/Infinium+OncoArray-500K+BeadChip+Kit/pm30205043-251-44-50 Average 93 stars, based on 1 article reviews
wg 355 1001 truseq rna sample preparation v2 illumina cat - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |