bowtie2 version 2.2.5 Search Results


90
SourceForge net bowtie2 (version 2.2.5
Bowtie2 (Version 2.2.5, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/bowtie2/pmc06652224-200-5-8
Average 90 stars, based on 1 article reviews
bowtie2 (version 2.2.5 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare bowtie2
Bowtie2, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/bowtie2/pmc09064024-104-29-35
Average 90 stars, based on 1 article reviews
bowtie2 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
SourceForge net bwa version 0.7.12
Bwa Version 0.7.12, supplied by SourceForge net, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/bwa+mem/pmc05551020-269-10-14
Average 90 stars, based on 1 article reviews
bwa version 0.7.12 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
Refgen Technologies INC maize b73 reference genome refgen_v3
Maize B73 Reference Genome Refgen V3, supplied by Refgen Technologies INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/b73+reference+genome/pmc05452966-86-7-11
Average 90 stars, based on 1 article reviews
maize b73 reference genome refgen_v3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

99
Illumina Inc prep kit
Prep Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/TruSeq+DNA+Library+Prep/pmc09525273-351-10-12
Average 99 stars, based on 1 article reviews
prep kit - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

98
Illumina Inc hiseq 2500
Hiseq 2500, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/HiSeq+2500+Installation+and+Operational+Qualification/pmc09175372-97-6-8
Average 98 stars, based on 1 article reviews
hiseq 2500 - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare tophat2 release 2.0.13
Tophat2 Release 2.0.13, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/tophat2/pmc06147129-316-26-38
Average 90 stars, based on 1 article reviews
tophat2 release 2.0.13 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Partek partek flow software
Partek Flow Software, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/flow+partek+software/bio_rxiv__2025__10__16__681134-170-8-14
Average 86 stars, based on 1 article reviews
partek flow software - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare blastn tool
Blastn Tool, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/blastn+tool/pmc11942432-116-36-66
Average 90 stars, based on 1 article reviews
blastn tool - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Tree Star Inc carlifornia flowjo 8 7 treestar
Carlifornia Flowjo 8 7 Treestar, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/7+8+carlifornia+flowjo+treestar/pm28514690-258-62-65
Average 86 stars, based on 1 article reviews
carlifornia flowjo 8 7 treestar - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

94
Addgene inc gatccagttcacatcgctata
Gatccagttcacatcgctata, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/AAV-shRNA-ctrl+(Plasmid+%2385741)/pm37209098-167-62-69
Average 94 stars, based on 1 article reviews
gatccagttcacatcgctata - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

93
Illumina Inc wg 355 1001 truseq rna sample preparation v2 illumina cat
Wg 355 1001 Truseq Rna Sample Preparation V2 Illumina Cat, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bowtie2+version+2%2E2%2E5/Infinium+OncoArray-500K+BeadChip+Kit/pm30205043-251-44-50
Average 93 stars, based on 1 article reviews
wg 355 1001 truseq rna sample preparation v2 illumina cat - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

Image Search Results